Complement a DNA sequence

Question

Suppose I have a DNA sequence. I want to get the complement of it. I used the following code but I am not getting it. What am I doing wrong ? ``` s=readline() ATCTCGGCGCGCATCGCGTACGCTACTAGC p=unlist(strsplit(s,"")) h=rep("N",nchar(s)) unlist(lapply(p,function(d){ for b in (1:nchar(s)) { if (p[b]=="A") h[b]="T" if (p[b]=="T") h[b]="A" if (p[b]=="G") h[b]="C" if (p[b]=="C") h[b]="G" } ```

Accepted Answer

Use `chartr` which is built for this purpose:

```
> s
[1] "ATCTCGGCGCGCATCGCGTACGCTACTAGC"
> chartr("ATGC","TACG",s)
[1] "TAGAGCCGCGCGTAGCGCATGCGATGATCG"
```

Just give it two equal-length character strings and your string. Also vectorised over the argument for translation:

```
> chartr("ATGC","TACG",c("AAAACG","TTTTT"))
[1] "TTTTGC" "AAAAA" 
```

Note I'm doing the replacement on the string representation of the DNA rather than the vector. To convert the vector I'd create a lookup-map as a named vector and index that:

```
> p
 [1] "A" "T" "C" "T" "C" "G" "G" "C" "G" "C" "G" "C" "A" "T" "C" "G" "C" "G" "T"
[20] "A" "C" "G" "C" "T" "A" "C" "T" "A" "G" "C"
> map=c("A"="T", "T"="A","G"="C","C"="G")
> unname(map[p])
 [1] "T" "A" "G" "A" "G" "C" "C" "G" "C" "G" "C" "G" "T" "A" "G" "C" "G" "C" "A"
[20] "T" "G" "C" "G" "A" "T" "G" "A" "T" "C" "G"
```

Complement a DNA sequence

Solution

Problem