How to iterator over every [:2] overlapping characters in a string of DNA code?
for-loop, iterator, n-gram, python, string
Solution
Just leave out the `,2` in your range and make sure to not arrive at the very end of your string:
for i in range(0, len(input)-1):
print input[i:i+2]
The `,2` tells Python to step forward two on every iteration. By leaving it out, you default to stepping forward one.
Problem
Let's say I have a string of DNA 'GAAGGAGCGGCGCCCAAGCTGAGATAGCGGCTAGAGGCGGGTAACCGGCA' Consider the first 5 letters: GAAGG And I want to replace each overlapping bi-gram 'GA','AA','AG','GG' with some number that corresponds to their likelihood of occurrence, summing them. Like 'GA' = 1, 'AA' = 2, 'AG' = .7, 'GG' = .5. So for GAAGG I would have my sumAnswer = 1 + 2 + .7 + 5. So in pseduo code, I want to... -iterate over each overlapping bi-gram in my DNA string -find the corresponding value to each unique bi-gram pair -sum each value iteratively I'm not enitrely sure how to iterate over each pair. I thought a for loop would work, but that doesn't account for the overlap: it prints every 2-pair (GAGC = GA,GC), not every overlapping 2-pair (GAGC = GA,AG,GC) ``` for i in range(0, len(input), 2): print input[i:i+2] ``` Any tips?